Skip to main content

Table 2 Sequences of primers used for PCR and expected product size

From: Detection of trypanosomes in small ruminants and pigs in western Kenya: important reservoirs in the epidemiology of sleeping sickness?

Trypanosome species Primer sequence 5'-3' Size (bp) Reference
T. Congolense savannah For: CGAGAACGGGCACTTTGCGA 316 [28]
  Rev: GGACAAACAAATCCCGCACA   
T. congolense Kilifi For: GTGACCAAATTTGAAGTGAT 294 [28]
  Rev: ACTCAAAATCGTGCACCTCG   
T. vivax For: CCCGGCAGGTTGGCCGCCATC 399 [29]
  Rev: TCGCTACCACAGTCGCAATCGCAATCGTCGTCTCAAGG   
T. simiae For: CCGGTCAAAAACGCATT 437 [28]
  Rev: AGTCGCCCGGAGTCGAT   
T. brucei For: GAATATTAAACAATGCGCAG 164 [28]
  Rev: CCATTTATTAGCTTTGTTGC   
SRA – T. b. rhodesiense SRA-A: 5'GACAACAAGTACCTTGGCGC 460 [18]
  SRA-E: 5'TACTGTTGTTGTACCGCCGC)